Revista online editata de Clinica Urechii (clinicaurechii.ro)
miercuri martie 29th 2017

Hipoacuzia si cauzele GENETICE

Auzul este un proces complex, si de aceea nu trebuie sa fim surprinsi de multitudinea cauzelor ce pot determina surditate.

In functie de zona afectata surditatea poate fi:

  1. de conducere (canalul auditiv, timpanul, urechea medie)
  2. neurosenzoriala (cohleea, nervul auditiv sau creierul)

Din punct de vedere al cauzelor ce pot determina hipoacuzie, majoritatea acestora sunt de cauza genetica:

  • Idiopatic reprezinta cele la care pina in momentul actual nu li se poate determina vreo cauza anume
  • Non-genetica pot fi datorate unor infectii, unor tratamente cu antibiotice, probleme structurale, prematuritate, hipoxie, hiperbilirubinemie, traumatisme fizice (expunere la zgomote puternice, leziuni ale capului, hipoxie, etc.)
  • Genetice cea mai frecventa cauza. Spunand despre surditate ca este „genetica” inseamna ca s-a produs o modificare intr-o gena.

schema

  • Omul are acelasi set de gene in fiecare celula a corpului
  • Genele „spun” celulelor cum sa functioneze
  • Cand apare o schimbare intr-o gena, se numeste MUTATIE
  • O mutatie poate oprii o gena sa functioneze normal
  • Pot exista familii in care surditatea sa apara pe parcursul mai multor generatii ( si aici vorbim de transmitere ereditara), sau poate sa fie ca si caz izolat de surditate dar care ulterior in functie de tipul de mutatie sa-l transmita descendentiilor.
  • Desi un istoric familial poate ajuta la gasirea cauzei genetice, absenta acestui istoric de hipoacuzie la membrii familiei nu inseamna ca surditatea nu e de cauza genetica. De fapt, hipoacuzia de cauza genetica poate apare la un copil ai carui parinti aud normal, si care nu au avut rude cu hipoacuzie.
  • De aceea e important sa se coreleze informatiile obtinute din examinarea fizica, testele clinice, istoricul familial (arborele genealogic), si testele genetice pentru a identifica cauza. Acest lucru poate ajuta in stabilirea tratamentului si managementului hipoacuziei, si poate prezice posibilitatea transmiterii acestei afectiuni generatiilor urmatoare.

Hipoacuzia genetica poate fi clasificata in 2 mari grupuri:

1) Sindromica: reprezinta aproximativ 30% din cele cu cauza genetica. La acesti pacienti pe langa hipoacuzie se mai asociaza si alte probleme de sanatate, ca de exemplu:

Numele sindromului Alte simptome (in afara de hipoacuzie)
Alport Probleme renale
Pender Marirea glandei tiroide
Usher Scaderea acuitatii vizuale (orbire progresiva)
Jervell Lange Nielsen Probleme cardiace (aritmii)
Stickler Trasaturi faciale neobisnuite, probleme oculare, artrita
Neurofibromatoza tip 2 Tumori ale nervului vestibulo auditiv
BOR (Brahio-OTO-Renal) Chisturi in regiunea gatului si afectiuni renale
Waardenburg Schimbari in pigmentarea pielii si heterocromie iriniana (ochii de culori diferite)
Norrie Simptome oculare (pseudotumoră de retină, cataractă, hiperplazie retiniană), tulburări psihice cu sau fără retardare mentală
Treacher Collins Boală a dezvoltării craniofaciale (fante palpebrale oblice, colobom, micrognaţie, urechi mici şi alte anomalii ale urechii)
Goldenhar (Oculo-Auriculo-Vertebral) Asimetrie facială de grade variate, anomalii oculare (anomftalmie), anomalii auriculare, modificări vertebrale cu malformaţii ale bazei craniului

De obicei sunt boli rare în care pierderea auzului este considerată o caracteristică majoră. Poate necesita pe langa cele din sfera genetica si ORL, alte evaluări medicale: oftalmologice, renale, cardiace, etc.

2) Non-sindromice: reprezinta 70% din cazurile de hipoacuzie genetica. In aceasta situatie persoana prezinta doar surditate.

MUTATIILE GENELOR

Pot fi DOMINANTE sau RECESIVE:

Omul are 46 de cromozomi, in perechi de cite 2 ( deci fiecare gena este dublu reprezentata).

Daca o singura gena este afectata si determina aparitia bolii, se spune despre aceasta mutatie ca este dominanta ( „este puternica”).

In cazul mutatiilor recesive, alterarea genei nu este suficient de puternica pentru a determina boala daca pacientul are o singura gena afectata. In concluzie, un copil trebuie sa mosteneasca 2 gene afectate, cite una de la fiecare parinte, pentru a prezenta hipoacuzie. Persoanele (parintii) care au o gena normala si o gena cu mutatie recesiva se numesc PURTATORI. Aceste persoane nu sunt afectate, dar pot transmite mutatia copiilor. Deoarece parintii sunt purtatori si prin urmare nu fac boala, aceasta forma de ereditate (transmitere) este cea mai frecventa cind nu exista istoric familial de surditate. Majoritatea cazurilor de hipoacuzie datorate mutatiei genei CONEXINEI 26 respecta acest model recesiv.

In plus fata de aceste doua modele de transmitere, mai pot exista:

  • transmiterea recesiva legata de cromozomul X.

La sexul feminin (are 2 cromozomi X), pentru ca o femeie sa fie afectata, ea trebuie sa aiba mutatii pe amandoi cromozomii X
La sexul masculin (are 1 cromozom X si 1 cromozom Y), un fiu va avea nevoie de o singura gena mutanta pentru a fi afectat.

  • transmiterea mitocondriala

Reprezinta o forma speciala de transmitere. O mama afectata va avea toti copii afectati, in timp ce un tata afectat va avea toti copii sanatosi.

Ce sunt Testele Genetice?

Testarea genetica este un proces complex prin care se compara secventa unei gene particulare a persoanei investigate cu secventa stabilita ca normala (standard) pentru gena respectiva. Prin aceasta comparare se pot identifica mutatiile ce determina oprirea sau functionarea defectuoasa a genei.

Este important de amintit ca o persoana poate fi testata doar pentru genele care au fost descoperite si la care sa stabilit secventa normala ( !!! Mai pot fi implicate si alte gene, dar care inca nu au fost descoperite !!!).

Dintre genele descoperite, cea mai studiata este gena pentru CONEXINA 26 (situata pe cromozomul 13). Gena determina sinteza unor proteine, ce formeaza un canal denumit Conexon. Prin acest canal se realizeaza schimburi de electroliti (K+) implicati in reglarea balantei osmotice necesare celulelor ciliate. Unda sonora loveste celulele ciliate, iar miscarea acestora este transformata in semnal electric, ce va fi trimis prin intermediul nervului auditiv la creier.

Aproximativ 75-80% din cazurile de hipoacuzie sunt determinate de mutatii in aceasta gena, iar cea mai frecventa mutatie intalnita este 35delG.

Clasic se investigheaza doar prezenta sau absenta acestei mutatii. Totusi, lipsa acestei mutatii nu exclude prezenta altei mutatii in gena. Acest lucru poate fi identificat prin secventiere.

…CTGGGGGGTGTGAACAAACAC… Aude (normal)
…CTGGGGGTGTGAACAAACAC… Hipoacuzie (surditate/mutatie)

In cadrul mutatiei 35delG se pierde un singur acid nucleic (Guanina), iar acest lucru duce la functionarea defectuoasa a genei si a sintezei proteice.

Metoda de lucru

  • Se recolteza minim 1 ml singe, in eprubeta cu EDTA.
  • Din acesta in laboratorul de genetica se izoleaza ADN-ul (materialul raspunzator de transmiterea caracterelor ereditare). Intrucit cantitatea de ADN obtinuta este foarte mica pentru a se putea lucra cu el, ADN-ul va fi multiplicat prin tehnica de PCR (Polymerase chain reaction). Se obtin in acest mod suficiente copii ale secventei genei investigate, ce pot fi analizate ulterior.
  • ADN-ul multiplicat va fi introdus intr-un sistem automatizat, computerizat in care se va identifica ordinea si secventa acizilor nucleici din gena studiata. ADN-ul v-a fi trecut prin dreptul unei raze laser, iar modificarile in lungimea de unda a cesteia vor fi interpretate computerizat in secventele genelor. Secventa astfel obtinuta v-a fi comparata cu secventele standard din bancile genomice internationale, putindu-se identifica orice modificare.

aparat adn

Leave a Reply

You must be logged in to post a comment.



*/